Product ID S714388
Vector name pLightSwitch_Prom
Gene symbol SYT8
Insert length 1859
Restriction pair MLU1BGL2
NOTE The sequence below is sequence from the reference human genome. The actual cloned fragment may contain SNPs or other naturally occurring sequence variants.
Sequence
CCCAGGCTTAAGTACCATGTGTCATGGGGGATTCAGAGGGTTCAACAGGTGGGGGGCACG
CTGTCGTGGCACCCTGGTGACAACAGGAGACCAAGGAGGGGCAGGTCACCTGGCCCTGGG
CATGAGGGAGGGGGCTGCACAGGCACTCAGGTCCCCAAGCTGTGTCTCCCAGGCACTCTC
AGGCGTGGGGTGTAAAGATGCTGATGCCAGGGTTCCCCATGAACACAGACCCCCCTAAAC
AAGGTAAATGGGGTCCACACAAAAGTTGTGGGGGATCAGGCCCCTGCCATGAGGTCCCCA
AGGCCCTTGGGAGATGAGGTCAATGCGGGGAGGACCGGGAGAACCCCCGTCCTCTGACAT
GGTGGCTGCAGTACCAGCCATTTGAGGAGTGGGTTACATGCCCCCAGACTTCCAGGTGAC
GGGGGTGGCCACCCAGACACTTCAAGACATGGGGTTTTCATCACCAAAATCCAGATGCAG
ATTCTCAGAGGATAGGAACTGAGCCCATGGAATCAGCACCAGCCATGTTCAGAGGGTGCA
GACCCCCATGCCCAAGACGGAGCAGAGCCTCCCAGAGGCTCGGTGATGGGGTGCAGCCTC
CACGGAGGCTCGATGATGGGGTGCAGCCTCTCTGGAGGCTCAGGTCATGGGGTACAGCCT
CCCCGGAGGCTCAGGTCATGGGATGCAGCCTCCCAGAGGCTCGGTGATGGGGTGCAGCCT
CCCCAGAGGCTCAGGTCATGGGGTGCAGCCTCCTCCCAGAGGCTCGGTGATGGGGTGCAG
CCTCCCCAGAGGCTCAGGTCATGGGGTGCAGCCTCCCCAGATGCCTGGTTGATGGGGTAC
AGCCTCCCGGGATGAAGAGGCACAGACAGTATGCATGAAAGGTGAGTGTGGCACACACAA
GCTAAGACACAGAGAATGGGCATAGGGCATCCCAAAGCACAGAGAACTGTGGCAAGCTGA
GTTCCCCCATCCCCGGCCATCCCGGGCCCCAGCTGATGAGGGTGCCCCAGCCCTGCAGGG
CTCAGCAGCTGGGGTCAGAGTGGGTGGGGCAAACACGCGCTCACCCAGCACACTTTTCTT
TGTGTGCCAGTGACTCCTGGCTCCCCAGAGCCAGCGCTTGCTTTGCAGTCCAACCTCAAG
CATTCCCCAGGCGACCTCAGAGGAAGCGTCCCCATCCAGGAGCCCCACCAGGGTCTCCAT
GAGGCTGCTGGCTGCCAAGCCACCGTCTCGGGGCCTCGGGACTGGCCTCGGGCTCCAGCT
CTGTTTGGTTTTCTCCTTCCTGCCCTGGAACCTCAGACGCCAGTCTGGCTGTGAAGGCGC
CCATATACTGGGGAAAGTACAAAGCCCCTACACAGCTGGCTGCAGAGAACCGCGCGCAGG
GCACGTAGCTCAGCTGTACCCTGGGGCCAGCGTCGAGCCACCCCCTGCATGTGTCCCCTT
GCTTGCCTAAAAGCCCCACTAGGGCAGCCTCTGGCCCTTCTCATCCCAGATTGAGTCAGA
CTAGGAGACAGACCCATACCCTGTGCAAACACCAGAAGGACGTACAAGTCCCCACACGCC
CAGGGCCGCGTGTGACCGGACGGGCCCAGACGTGCACATGCATGCCCACACGTCCTCCTG
CTGTGGCCCGAAAGCATCCTCGGAGCCTGGGCTATGTCCTCCACACTTGCTGCCTGACCA
GCCCCGTGGGGCCGGCCCCGCTGGGACAGGTTTTCCCGTTAAGCATTAACCACCAGCAGA
TAAGGGCTCTGAGGGAACGCCCTGACCTGGGATGGCTGCTCCTCGGTAGGCCCAAGTCAT
GGATCTGACTAGAGTGACCAGACCAGACTAACTGGCAGAGCAGAGGGAGAGGAGCTTAG