Product ID S717349
Vector name pLightSwitch_Prom
Gene symbol DNAJB6
Insert length 1089
Restriction pair MLU1BGL2
NOTE The sequence below is sequence from the reference human genome. The actual cloned fragment may contain SNPs or other naturally occurring sequence variants.
Sequence
CAACACAGTAGCAAACATCTGGCTGAATGCTGGAGAGGAAGACAGTGGGAGATCCAGGCC
AGGCTCCATGGACGAACTGCTTGTTGGCTCCTTAGGCTTTGGGTCTGCGGGACCCTTTCG
CTACTGGGAATGGGAGCCTGTCTGACTGCACTGGGTCTGAGACTCCCTGCTCCTGCTGGT
CACCATCTACACGCATGTGGTGTTGGTCTCCAGGGTTAGAACCAGAACCCCTGAGGACGC
GGGAAAGGCTAGGAAGCCTGGGGATGACCTAAAGTCCAGCTATCAAAATGCGCCGCGTTT
TCAGAAAAACTACTGCCACGATTTAACCTAAAAAGCTTCATCTGTATTTTCTGCCACAGT
TTGCTTCCGTTTCCTTCAGTCACTATTCCCTGGCGAAGTCTCCACGCGCTCCCGTTCGCC
GGGGAACTTAGGGTATCCGGGCTTCCCTAAATTGACAAGCGGGGGCCGGCGCCTTCGCCC
GCCTTCGCTGGCCGCCGCTTGGTTTGTTCTTCTTCTCCTTCGGGGACTTCTCCGCCCGCG
CCCGCGCCCGCGCCCCAGCTTTCGTCCCGCTGTGCGGAGATGCCACCCAGCTCCACCGCA
GGACCGCGGAGCGAGAGGCGGCAGACGCGCTCCGGGGGCCGCCGGTCAAGAGGAAGATGA
AGGGCGCGACGACTTCGCGGTTTCCAGAATGGGCTCCTTCTGGCCCAACAATAAGTGCCA
TTTGGAATCTTCTCGGCCTTCTCTGTGCCTTCCGCGCGTCTGGGCTCCCCGGTACCGTAG
ACCCGGCCCCGAGCTCCGCCCCCTCGCCCTGGGCTTCCCCGCCCCCTCGCCCCCAGTCTC
CTGGGCTCTTCGGGGCGGCGGAAGAGCCGAGAACCTTCGCGAAGGTGGGGCGGGCGCCCC
CGAGGTTGGGCCCGCGGTATGGGCAGTGGAAACTGCGCATGCGCGGCGTCAGGGTCGGGC
GGAAGTTGACGCCGCCGTGCCGCCGCCGCGTGACGCATTTCCTGTTTGTTGTTGGAGAAA
GGAGAGAAAGGAAAGCGCGAGGAGCCGCCGCCACCACCAGCGCAGCAGTCCTGGAGCTGT
GAGGAGATT