Product ID S717678
Vector name pLightSwitch_Prom
Gene symbol ACTB
Insert length 1000
Restriction pair MLU1BGL2
NOTE The sequence below is sequence from the reference human genome. The actual cloned fragment may contain SNPs or other naturally occurring sequence variants.
Sequence
ATAGCAGACATACAACGGACGGTGGGCCCAGACCCAGGCTGTGTAGACCCAGCCCCCCCG
CCCCGCAGTGCCTAGGTCACCCACTAACGCCCCAGGCCTTGTCTTGGCTGGGCGTGACTG
TTACCCTCAAAAGCAGGCAGCTCCAGGGTAAAAGGTGCCCTGCCCTGTAGAGCCCACCTT
CCTTCCCAGGGCTGCGGCTGGGTAGGTTTGTAGCCTTCATCACGGGCCACCTCCAGCCAC
TGGACCGCTGGCCCCTGCCCTGTCCTGGGGAGTGTGGTCCTGCGACTTCTAAGTGGCCGC
AAGCCACCTGACTCCCCCAACACCACACTCTACCTCTCAAGCCCAGGTCTCTCCCTAGTG
ACCCACCCAGCACATTTAGCTAGCTGAGCCCCACAGCCAGAGGTCCTCAGGCCCTGCTTT
CAGGGCAGTTGCTCTGAAGTCGGCAAGGGGGAGTGACTGCCTGGCCACTCCATGCCCTCC
AAGAGCTCCTTCTGCAGGAGCGTACAGAACCCAGGGCCCTGGCACCCGTGCAGACCCTGG
CCCACCCCACCTGGGCGCTCAGTGCCCAAGAGATGTCCACACCTAGGATGTCCCGCGGTG
GGTGGGGGGCCCGAGAGACGGGCAGGCCGGGGGCAGGCCTGGCCATGCGGGGCCGAACCG
GGCACTGCCCAGCGTGGGGCGCGGGGGCCACGGCGCGCGCCCCCAGCCCCCGGGCCCAGC
ACCCCAAGGCGGCCAACGCCAAAACTCTCCCTCCTCCTCTTCCTCAATCTCGCTCTCGCT
CTTTTTTTTTTTCGCAAAAGGAGGGGAGAGGGGGTAAAAAAATGCTGCACTGTGCGGCGA
AGCCGGTGAGTGAGCGGCGCGGGGCCAATCAGCGTGCGCCGTTCCGAAAGTTGCCTTTTA
TGGCTCGAGCGGCCGCGGCGGCGCCCTATAAAACCCAGCGGCGCGACGCGCCACCACCGC
CGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTG